Please input your sequence in FASTA format, e.g.
> COMMENTS
ACATCTGCTATAAAATACGATGCAGTCACGT
or select FASTA format file
TFBIND : Software for searching transcription factor binding sites
(including TATA boxes, GC boxes, CCAAT boxes, transcription start sites
(TSS)).
This tool uses weight matrix in transcription factor database TRANSFAC
R.3.4
developed by Dr. Wingender et al, and the cut-offs originally estimated
by our research.
Output format (space-separated):
Column1: Transcription factor matrix ID (from TRANSFAC R.3.4).
Column2: Transcription factor label (from TRANSFAC R.3.4). V means vertebrate.
Column3: Similarity (0.0-1.0) between a registered sequence for the transcription factor binding sites and the input sequence (at the position shown in the next column).
Column4: Position on the input sequence.
Column5: Strandness. + and - means forward and reverse strands that the transcription factor binds, respectively.
Column6: Consensus sequence (fixed) of the transcription factor binding sites. S = C or G, W = A or T, R = A or G, Y = C or T, K = G or T, M = A or C, N = any base pair.
Column7: Subsequence from the input sequence at the position - corresponding to the consensus sequence.
Professor
Department of Medical Science Mathematics, Medical Research Institute, Tokyo Medical and Dental University
1-5-45, Yushima, Bunkyo, Tokyo, 113-8510, JAPAN
Group Director, Chief Scientist
Medical Science Mathematics, RIKEN Center for Integrative Medical Sciences
1-7-22, Suehiro, Tsurumi, Yokohama, 230-0045, JAPAN